Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.150153 |
Chromosome: | chromosome 14 |
Location: | 497190 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611300 | COP3,CHR1,CSOA | (1 of 7) PF01036 - Bacteriorhodopsin-like protein (Bac_rhodopsin); Channelrhodopsin 1 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCATACTCCAAGCGTTCTTGGAGGCAAG |
Internal bar code: | GCTTGCCTGTGGACCCGTAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1073 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 764 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCATCTTGCCCATCTCCAT |
Suggested primer 2: | TCATTTTCTTCCTGATGGGC |