| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.151952 |
| Chromosome: | chromosome 16 |
| Location: | 3516452 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677026 | PDH1 | Pyruvate dehydrogenase E1 beta subunit; (1 of 2) K00162 - pyruvate dehydrogenase E1 component beta subunit (PDHB, pdhB) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGCAGCACCCTCTCCACAGCCAGGGTGT |
| Internal bar code: | TCTCTTCTTGGGGGGTCCCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 99.3311 |
| LEAP-Seq n confirming: | 2079 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATTGGTGGTGCCTCATTA |
| Suggested primer 2: | GCCTGTTTCTGTCCTCAAGC |