| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.152421 |
| Chromosome: | chromosome 13 |
| Location: | 2135768 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g577950 | VPS60 | Subunit of the ESCRT-III complex; (1 of 1) K12198 - charged multivesicular body protein 5 (CHMP5, VPS60) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCCTTGCTTGATACGCTGCTTCATGCT |
| Internal bar code: | TGCCGTATTCCGCGAGGTCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 95 |
| LEAP-Seq percent confirming: | 95.9893 |
| LEAP-Seq n confirming: | 718 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACTCTCGTCGCACCCTCT |
| Suggested primer 2: | ATCCACACCTGTTCTTTCGC |