| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.153731 |
| Chromosome: | chromosome 1 |
| Location: | 7339276 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g052750 | (1 of 1) PF06011//PF13418 - Transient receptor potential (TRP) ion channel (TRP) // Galactose oxidase, central domain (Kelch_4); Transient receptor potential ion channel | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAGCCGTACAAGAATGAGAAGATGAACA |
| Internal bar code: | GATTACACGTTCTTAAGTTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 896 |
| LEAP-Seq percent confirming: | 94.2394 |
| LEAP-Seq n confirming: | 8016 |
| LEAP-Seq n nonconfirming: | 490 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAAGTGAGTGAGGGAGG |
| Suggested primer 2: | GTCGTTTAGACCACTCCCCA |