| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.154772 |
| Chromosome: | chromosome 9 |
| Location: | 2051421 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394150 | RAA1,OPR40 | psaA mRNA trans-splicing factor; (1 of 3) PF06743 - FAST kinase-like protein, subdomain 1 (FAST_1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAAGCGGCTAGGAGCATCCATTGCCCGC |
| Internal bar code: | GCTGATGGCGTTCTGACGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 401 |
| LEAP-Seq percent confirming: | 99.2782 |
| LEAP-Seq n confirming: | 2751 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCACAACCCAACACTTG |
| Suggested primer 2: | CTTGGTACAGTTGTGGGGCT |