Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.155660 |
Chromosome: | chromosome 1 |
Location: | 5434449 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g038151 | (1 of 1) PTHR23069:SF0 - TAT-BINDING HOMOLOG 7 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGCCATGCCTGCAATAACCTGCGCGCC |
Internal bar code: | CCTATGCCGTTTGGTCGGCTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 543 |
LEAP-Seq percent confirming: | 41.5608 |
LEAP-Seq n confirming: | 229 |
LEAP-Seq n nonconfirming: | 322 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCCCTGTACCATCTTTGC |
Suggested primer 2: | AAAATCCACGTCAGCATTCC |