| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.157161 |
| Chromosome: | chromosome 12 |
| Location: | 5514781 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531150 | XYI1 | (1 of 1) 2.7.1.15//5.3.1.5 - Ribokinase // Xylose isomerase / D-xylose ketoisomerase; ribokinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCAAGGCACCCGGGTGCCACTCCCGGT |
| Internal bar code: | GGGACACGCGTATACGCGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 802 |
| LEAP-Seq percent confirming: | 96.5116 |
| LEAP-Seq n confirming: | 166 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCATGAGCGCTTAAATC |
| Suggested primer 2: | CTTAGCTGCCAGACCAGACC |