| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.157569 |
| Chromosome: | chromosome 13 |
| Location: | 4026794 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g591100 | MSCL3,MSC5 | (1 of 1) IPR000104//IPR002048//IPR006685//IPR010920 - Antifreeze protein, type I // EF-hand domain // Mechanosensitive ion channel MscS // LSM domain; Predicted protein with mechanosensitive ion channel domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACTTGTTTGGAAGCGCCCCAGCTTCCTT |
| Internal bar code: | TGCGGCGGCTTCAGTGACCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 495 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACATGCCCAACACAGCAC |
| Suggested primer 2: | GCAGTGGGAACACGGTAGAT |