| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158078 |
| Chromosome: | chromosome 10 |
| Location: | 5171937 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456650 | AOF6 | (1 of 1) 1.4.3.4 - Monoamine oxidase / Tyramine oxidase; Flavin-containing amine oxidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCTAGGCCGGACAGCGTGATTGGAATC |
| Internal bar code: | TCCAGCGCGGATATCTAGAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 99.9205 |
| LEAP-Seq n confirming: | 2514 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGCATGTCGAAGCTTGT |
| Suggested primer 2: | CAGTGCCAGGGAATACAGGT |