Insertion junction: LMJ.RY0402.158112_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.158112
Chromosome:chromosome_6
Location:5346924
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g283500 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):ACCCACACCCCACTCGCAGCTACCTACTAC
Internal bar code:GGCGGGTAACCCAGGGGGGGTG

Confirmation - LEAP-Seq

LEAP-Seq distance:452
LEAP-Seq percent confirming:58.4375
LEAP-Seq n confirming:187
LEAP-Seq n nonconfirming:133
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:TCGTGGTTGAGCAGTTTGAG
Suggested primer 2:ACCGGGTTTTTGGTGTAATG