| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.158560 |
| Chromosome: | chromosome 12 |
| Location: | 9211229 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541800 | (1 of 2) 3.4.21.26 - Prolyl oligopeptidase / Prolyl endopeptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTTCAACAGGCGGACGGGCAAAACGAT |
| Internal bar code: | AACCGAACCGATGGTTTTCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 504 |
| LEAP-Seq percent confirming: | 76.2963 |
| LEAP-Seq n confirming: | 103 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGAAGCTGGTGAATGAGA |
| Suggested primer 2: | GAGGAGGACAAGCTGACTGG |