| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.158924 |
| Chromosome: | chromosome 3 |
| Location: | 4731594 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177950 | (1 of 1) PTHR32093:SF10 - MUCIN 14A | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTTTTAAGACTCCCATTCAAGCCGCATA |
| Internal bar code: | GCGGATGTTAGAACCACCTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 407 |
| LEAP-Seq percent confirming: | 98.7008 |
| LEAP-Seq n confirming: | 2583 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAGACGACGTTGTTCTTG |
| Suggested primer 2: | TGCCACATCCGTACCATCTA |