Insertion junction: LMJ.RY0402.160721_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.160721
Chromosome:chromosome_13
Location:2135843
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g577950 VPS60 Subunit of the ESCRT-III complex antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCGCCACAACGGAGACACCAGAGTACCGT
Internal bar code:AGGAAGCTGACCAAACGCCGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:186
LEAP-Seq percent confirming:99.6667
LEAP-Seq n confirming:299
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:TTACTCTCGTCGCACCCTCT
Suggested primer 2:ATCCACACCTGTTCTTTCGC