| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.161054 |
| Chromosome: | chromosome 16 |
| Location: | 3136599 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665800 | SS4,SSS4 | Soluble starch synthase IV; (1 of 2) PTHR12526:SF304 - STARCH SYNTHASE 4, CHLOROPLASTIC/AMYLOPLASTIC-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCCTGACCGTCACGAAGTGGCCGCGCG |
| Internal bar code: | CCGCTGCGATCGCGTTTTTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 507 |
| LEAP-Seq percent confirming: | 94.9433 |
| LEAP-Seq n confirming: | 2178 |
| LEAP-Seq n nonconfirming: | 116 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGCAGACACGCTCATAC |
| Suggested primer 2: | AGTGGTCTCAAATGCAAGGG |