Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.161660 |
Chromosome: | chromosome 10 |
Location: | 5193479 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g456851 | TMG4 | tRNA (guanine-N1)-methyltransferase; (1 of 3) 2.1.1.221 - tRNA (guanine(9)-N(1))-methyltransferase / tRNA m(1)G(9)-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTGTACTTCAGCCCCGTGCGGCCGCG |
Internal bar code: | GCATGCCCTGGGATTAGGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 533 |
LEAP-Seq percent confirming: | 99.3716 |
LEAP-Seq n confirming: | 12019 |
LEAP-Seq n nonconfirming: | 76 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTTAGTGGGCGGGATTTG |
Suggested primer 2: | CCAGCTCAACTTGCTTTTCC |