| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161841 |
| Chromosome: | chromosome 1 |
| Location: | 4221431 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g028200 | DBP2,HEL6 | (1 of 1) PTHR24031:SF219 - ATP-DEPENDENT RNA HELICASE DDX5-RELATED; DEAD-box RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTGGTTCCTCCCGCGCACATCCGCTTTC |
| Internal bar code: | CCTAGGCGAGCGGCAAAAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1079 |
| LEAP-Seq percent confirming: | 81.9298 |
| LEAP-Seq n confirming: | 8873 |
| LEAP-Seq n nonconfirming: | 1957 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTATGTGTGTAGCATGCGG |
| Suggested primer 2: | TGGCACTGCCTACTCCTTCT |