| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.161869 |
| Chromosome: | chromosome 16 |
| Location: | 3887958 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690250 | PUS18 | TruB family RNA pseudouridine synthase; (1 of 1) K03177 - tRNA pseudouridine55 synthase [EC:5.4.99.25] (truB, PUS4, TRUB1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTGCGCCGCCACCTCTTTCCTCCCCTC |
| Internal bar code: | CTGTCATGGGGCGTTGTGCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 101 |
| LEAP-Seq percent confirming: | 56.5269 |
| LEAP-Seq n confirming: | 472 |
| LEAP-Seq n nonconfirming: | 363 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACATATCCACACACACGCA |
| Suggested primer 2: | CTTCTACGTGCACTGCTCCA |