Insertion junction: LMJ.RY0402.161956_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.161956
Chromosome:chromosome_3
Location:3045316
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre03.g164250 FAP262 Flagellar Associated Protein, protein kinase antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TTCTGGCTCTGCGGCTGTCTCCGGCTCAGC
Internal bar code:AATGGACAGGGTAATCAGGACC

Confirmation - LEAP-Seq

LEAP-Seq distance:1067
LEAP-Seq percent confirming:94.7529
LEAP-Seq n confirming:9300
LEAP-Seq n nonconfirming:515
LEAP-Seq n unique pos:46

Suggested primers for confirmation by PCR

Suggested primer 1:CTCAGGCAGGTCGTAGCTCT
Suggested primer 2:AGCAGCAGCTGAGGAGGTAG