| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.162167 |
| Chromosome: | chromosome 10 |
| Location: | 2509402 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436350 | SHK5,SHKF1 | (1 of 1) 2.7.1.71 - Shikimate kinase; Shikimate kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTCCGCCCCACACGCCCCACAGCACCG |
| Internal bar code: | TGCCCTGAAAAACTGACCACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 874 |
| LEAP-Seq percent confirming: | 96.1273 |
| LEAP-Seq n confirming: | 4170 |
| LEAP-Seq n nonconfirming: | 168 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGACACAACTGGCATAC |
| Suggested primer 2: | GCATGGTCAGTTGTGTGGTC |