Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.163206 |
Chromosome: | chromosome 16 |
Location: | 1220638 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g650900 | (1 of 1) IPR000104//IPR001965//IPR011011//IPR017956 - Antifreeze protein, type I // Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // AT hook, DNA-binding motif | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAGCCTGCATGCACCTATTCTCATCAGT |
Internal bar code: | GTTCCGGTCTAATTGCCGGGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 736 |
LEAP-Seq percent confirming: | 98.1472 |
LEAP-Seq n confirming: | 1907 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATACCGTGCAACTCCACAC |
Suggested primer 2: | GGCAACACAGGTTGAAGGTT |