Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.163529 |
Chromosome: | chromosome 1 |
Location: | 3893268 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g025400 | HYD3,HYDIN1 | (1 of 1) K17570 - hydrocephalus-inducing protein (HYDIN); Hydrocephalus 3-Like Protein Hydin | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCTGGAGGTGGCGTTTGAGCCGACGGCC |
Internal bar code: | GTATACTCAGTGAATCGCACGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 395 |
LEAP-Seq percent confirming: | 47.2067 |
LEAP-Seq n confirming: | 169 |
LEAP-Seq n nonconfirming: | 189 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACGAGTCTAGCGGGTGAG |
Suggested primer 2: | GGCGTACCCAGTTAACCTCA |