| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.164856 |
| Chromosome: | chromosome 7 |
| Location: | 4868661 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g346050 | CRD1,CHL27A | Copper response defect 1 protein; (1 of 2) 1.14.13.81 - Magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase / Mg-protoporphyrin IX monomethyl ester oxidative cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAAGGTGGCGTAGATGATGAACTTGGGC |
| Internal bar code: | GAGAAAGAAGTTAAAGCGTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1027 |
| LEAP-Seq percent confirming: | 99.5703 |
| LEAP-Seq n confirming: | 5329 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCAATAGCAGAAATGGAT |
| Suggested primer 2: | CAGCAAGGAGATTAACCCCA |