| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.165225 |
| Chromosome: | chromosome 17 |
| Location: | 2990423 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720300 | (1 of 6) PTHR27000//PTHR27000:SF160 - FAMILY NOT NAMED // LEUCINE-RICH REPEAT-CONTAINING PROTEIN DDB_G0281931-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTCACACACTCACAGGTCCCTCCTGCC |
| Internal bar code: | CAATTAGTATACAAGGCTTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 511 |
| LEAP-Seq percent confirming: | 92.2833 |
| LEAP-Seq n confirming: | 3779 |
| LEAP-Seq n nonconfirming: | 316 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACTACTCGCTGCTGGGTC |
| Suggested primer 2: | TAATGCCCTGCCAAGATACC |