| Insertion cassette: | CIB1 | 
| Side of cassette: | 3' | 
| Strand: | + | 
| Strain: | LMJ.RY0402.165360 | 
| Chromosome: | chromosome 1 | 
| Location: | 1948076 | 
| Confidence (%): | 58 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre01.g010450 | (1 of 19) PF00397 - WW domain (WW) | 3'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGGTCCCGCCTGCCGGGCCCCCAGCAA | 
| Internal bar code: | GACGGGGAACAGGTGAGCCTTT | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 527 | 
| LEAP-Seq percent confirming: | 99.537 | 
| LEAP-Seq n confirming: | 645 | 
| LEAP-Seq n nonconfirming: | 3 | 
| LEAP-Seq n unique pos: | 8 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTGCGTCTTGCAAATCA | 
| Suggested primer 2: | GACCGACTGCAGTGTTCAGA |