Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.165794 |
Chromosome: | chromosome 10 |
Location: | 5303064 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g457550 | ATG18 | (1 of 1) K17908 - autophagy-related protein 18 (WIPI, ATG18); Autophagy related | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACAGGTGGATGATGATGAGGTAGGGCAA |
Internal bar code: | AAAGGGATGACTCCCCTTAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1123 |
LEAP-Seq percent confirming: | 97.7974 |
LEAP-Seq n confirming: | 222 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGGATAAGTGGAAGCAGC |
Suggested primer 2: | CATACATGCATGCGCTACCT |