| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.165794 |
| Chromosome: | chromosome 10 |
| Location: | 5303064 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g457550 | ATG18 | (1 of 1) K17908 - autophagy-related protein 18 (WIPI, ATG18); Autophagy related | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACAGGTGGATGATGATGAGGTAGGGCAA |
| Internal bar code: | AAAGGGATGACTCCCCTTAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1123 |
| LEAP-Seq percent confirming: | 97.7974 |
| LEAP-Seq n confirming: | 222 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGGATAAGTGGAAGCAGC |
| Suggested primer 2: | CATACATGCATGCGCTACCT |