| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.166771 |
| Chromosome: | chromosome 16 |
| Location: | 376497 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693700 | UBC9 | Ubiquitin-conjugating enzyme E2; (1 of 2) K06689 - ubiquitin-conjugating enzyme E2 D/E (UBE2D_E, UBC4, UBC5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACTAGGTTTGGGCGCACTTAGGTCGCG |
| Internal bar code: | AAGAGCATTATGTATTTCGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1026 |
| LEAP-Seq percent confirming: | 99.4781 |
| LEAP-Seq n confirming: | 6099 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGTGGTCTGTTCCCTTC |
| Suggested primer 2: | GATCGCGCACATCTACAAGA |