| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.167187 |
| Chromosome: | chromosome 10 |
| Location: | 4616744 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452900 | SMY2 | (1 of 2) 3.1.4.12 - Sphingomyelin phosphodiesterase / Neutral sphingomyelinase; Sphingomyelin phosphodiesterase/sphingomylinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATACCACGGTGATCACGATGCGCACATA |
| Internal bar code: | CCACGGTGGGCACAAGGATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 198 |
| LEAP-Seq percent confirming: | 93.3467 |
| LEAP-Seq n confirming: | 2329 |
| LEAP-Seq n nonconfirming: | 166 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGTTGCTTCGCGTCTAC |
| Suggested primer 2: | GTTTGAAGTCATTCCAGCCG |