| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.167387 |
| Chromosome: | chromosome 10 |
| Location: | 4422611 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g451600 | SRR28,SRR28B | (1 of 1) PF00059//PF00704//PF14295 - Lectin C-type domain (Lectin_C) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // PAN domain (PAN_4); Lectin-domain glycosyl hydrolase | CDS|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTATCTTTTGATTGCAAGACTCCTGAC |
| Internal bar code: | CCTATTTCTTTCTCATGCGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 127 |
| LEAP-Seq percent confirming: | 99.6183 |
| LEAP-Seq n confirming: | 261 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTGTAGCCTTACCTGCC |
| Suggested primer 2: | AGCCCTTTAATGTGTCGGTG |