| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.167472 |
| Chromosome: | chromosome 6 |
| Location: | 3366206 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g277801 | DNL4,DNL7 | DNA ligase; (1 of 2) K10777 - DNA ligase 4 (LIG4, DNL4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGCCAAGCCGGGCCAAGCCAAGCCACGG |
| Internal bar code: | TGGAATCGCGACGCATTGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 140 |
| LEAP-Seq percent confirming: | 99.459 |
| LEAP-Seq n confirming: | 1103 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCAATAGGCCAATACTGT |
| Suggested primer 2: | GAGGCAGCGAACGAGATTAG |