| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.167591 |
| Chromosome: | chromosome 10 |
| Location: | 3098546 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441650 | (1 of 1) PF06650//PF16908 - SHR-binding domain of vacuolar-sorting associated protein 13 (SHR-BD) // Vacuolar sorting-associated protein 13, N-terminal (VPS13) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTCTTGCGTGGTGGCATCCTCCTTGTGT |
| Internal bar code: | AACTCGAACGATATCACACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1036 |
| LEAP-Seq percent confirming: | 99.7293 |
| LEAP-Seq n confirming: | 2579 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTACACCGGCGTTACAGAT |
| Suggested primer 2: | TCTTTGCACAGATGACGGAG |