| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.168619 |
| Chromosome: | chromosome 1 |
| Location: | 124715 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000950 | MFT13 | Major facilitator superfamily transporter; (1 of 3) PTHR23505:SF21 - SPHINGOLIPID TRANSPORTER SPINSTER HOMOLOG 1-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCTAATAACGCCCACGTCTGCGGCCTTC |
| Internal bar code: | GCTCTGAGTAATCGCATGCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 41 |
| LEAP-Seq percent confirming: | 98.0419 |
| LEAP-Seq n confirming: | 5658 |
| LEAP-Seq n nonconfirming: | 113 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTGAACAACTTGGGCTAC |
| Suggested primer 2: | CCAGCAGCACACAGAACACT |