| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168991 |
| Chromosome: | chromosome 1 |
| Location: | 3896189 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g025400 | HYD3,HYDIN1 | (1 of 1) K17570 - hydrocephalus-inducing protein (HYDIN); Hydrocephalus 3-Like Protein Hydin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAGGCGACCGGGCTGCGGCCGGTGGTGG |
| Internal bar code: | TCCGATCCGACCAGTCCTACCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 766 |
| LEAP-Seq percent confirming: | 99.6499 |
| LEAP-Seq n confirming: | 1423 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCATGATGTTCCAGACCC |
| Suggested primer 2: | TTGTAGCTCAGCTCGCACAC |