| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.169386 |
| Chromosome: | chromosome 6 |
| Location: | 1659217 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g261026 | (1 of 1) IPR001478//IPR014756 - PDZ domain // Immunoglobulin E-set | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCCTCGTCCTCCTTGCTGGGAGCCGGC |
| Internal bar code: | TGGCGGGTACCGGGTGATCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 291 |
| LEAP-Seq percent confirming: | 73.8579 |
| LEAP-Seq n confirming: | 291 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCAGCCCAAACTAAACCG |
| Suggested primer 2: | GTGTGCGTGTGTGTTTGTGA |