Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.172082 |
Chromosome: | chromosome 16 |
Location: | 5813647 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g678000 | CPL22 | (1 of 4) PF11891 - Domain of unknown function (DUF3411) (DUF3411); Conserved in the Plant Lineage | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACGGCGCCGAACTCGACAAGAAAGTTTG |
Internal bar code: | GGTTTGCGACACTGCGCTTGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 779 |
LEAP-Seq percent confirming: | 98.9362 |
LEAP-Seq n confirming: | 186 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACAGTTTCCAAGGCTCGC |
Suggested primer 2: | CTCCTTGCACCTTAATGGGA |