Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.172368 |
Chromosome: | chromosome 12 |
Location: | 7536620 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555700 | DNJ15 | DnaJ-like protein; (1 of 5) IPR000104//IPR001623 - Antifreeze protein, type I // DnaJ domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGAACACAGCTTTCGGGCCGGGCGCCCC |
Internal bar code: | AAAATGCGTTGCGCCAAGGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 722 |
LEAP-Seq percent confirming: | 99.7743 |
LEAP-Seq n confirming: | 4421 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTTGCTGGGATTTCCACT |
Suggested primer 2: | GGTTCCAAATACGCTGTCGT |