| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.172449 |
| Chromosome: | chromosome 1 |
| Location: | 498761 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g002787 | SRR24A,SRR24 | (1 of 1) PF00059//PF00530//PF00704//PF03762 - Lectin C-type domain (Lectin_C) // Scavenger receptor cysteine-rich domain (SRCR) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // Vitelline membrane outer layer protein I (VOMI) (VOMI); Scavenger receptor cysteine-rich protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCATCAAATTTTGGCACGTGGTTCGGC |
| Internal bar code: | ATTGCGGGTCCCGATCGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 253 |
| LEAP-Seq percent confirming: | 98.6111 |
| LEAP-Seq n confirming: | 142 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCACGCCTGTTTGATTTG |
| Suggested primer 2: | ATAAACCCGGGCCTAACAAC |