| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.172721 |
| Chromosome: | chromosome 10 |
| Location: | 2928519 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440300 | SMC5A | (1 of 2) PTHR19306//PTHR19306:SF1 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // STRUCTURAL MAINTENANCE OF CHROMOSOMES PROTEIN 5; Structural Maintenance of Chromosomes protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCACCGCCTCCCCCTCCACACACAAGC |
| Internal bar code: | GTGATAGTCTGCCGCTACCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 325 |
| LEAP-Seq percent confirming: | 99.7179 |
| LEAP-Seq n confirming: | 16969 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCAGCTGGGTATCTACTT |
| Suggested primer 2: | AAGAATGCAAAACCACCCTG |