| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.173155 |
| Chromosome: | chromosome 16 |
| Location: | 5815231 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678000 | CPL22 | (1 of 4) PF11891 - Domain of unknown function (DUF3411) (DUF3411); Conserved in the Plant Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGTTGACTGACGGCCCATTCCCGGATCC |
| Internal bar code: | CAACTGTGACTCACACTCGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 852 |
| LEAP-Seq percent confirming: | 82.9653 |
| LEAP-Seq n confirming: | 263 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGTTGTTGTTGGCTTTGA |
| Suggested primer 2: | TAGGTGGATGGGGGTTTACA |