Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.173201 |
Chromosome: | chromosome 4 |
Location: | 2656748 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g223050 | CAH2 | (1 of 2) PTHR18952:SF104 - CARBONIC ANHYDRASE-RELATED PROTEIN; Carbonic anhydrase, alpha type%252C periplasmic | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTGTGTCAGACTTCAAATCGGACTCGAA |
Internal bar code: | CATGTACTATCTTTCCGATGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 109 |
LEAP-Seq percent confirming: | 83.9181 |
LEAP-Seq n confirming: | 287 |
LEAP-Seq n nonconfirming: | 55 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAATCAAGCTGGGGACGAA |
Suggested primer 2: | TGGATCAAGGAGGATCAAGG |