| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173330 |
| Chromosome: | chromosome 3 |
| Location: | 4556854 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176833 | NAP1,NAP,DII5 | (1 of 7) PF00022 - Actin (Actin); Novel actin protein 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGTTGGAGAGCGTGTGTAGGGAGGAAG |
| Internal bar code: | GCTAGTGCCGCCTGGCGTCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 570 |
| LEAP-Seq percent confirming: | 95.7486 |
| LEAP-Seq n confirming: | 1554 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTCGGCAGCCTCTCAAC |
| Suggested primer 2: | ATGGACCTTGAATGTCAGGC |