| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173645 |
| Chromosome: | chromosome 16 |
| Location: | 6504548 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673001 | FAD4,LCI2 | (1 of 1) PTHR24067:SF41 - AKT-INTERACTING PROTEIN; Fatty acide desaturase 4 | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACCCACTCGGCGTTGTACGACGCACGC |
| Internal bar code: | GCCGATAAGGCTACGGGCTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 338 |
| LEAP-Seq percent confirming: | 99.3377 |
| LEAP-Seq n confirming: | 450 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATGGACACCCAAGTCCAG |
| Suggested primer 2: | TCTTTGTTGCAATTCTTGCG |