Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.173809 |
Chromosome: | chromosome 16 |
Location: | 5812782 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g678050 | SRS14,SRE3 | Pre-mRNA splicing factor, SR-related; (1 of 1) K13171 - serine/arginine repetitive matrix protein 1 (SRRM1, SRM160) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACGATAGGGCAGCGTGTGGAGGTCACAA |
Internal bar code: | GCTCTGAAGTACTCGCGGGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 401 |
LEAP-Seq percent confirming: | 99.5876 |
LEAP-Seq n confirming: | 7969 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCGAAGATACGAACGCTA |
Suggested primer 2: | AGCATAAACAGCAACCCCAC |