| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173971 |
| Chromosome: | chromosome 13 |
| Location: | 2226677 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578501 | (1 of 1) IPR009060//IPR015940//IPR026741//IPR026937//IPR027417 - UBA-like // Ubiquitin-associated domain // Protein strawberry notch // Strawberry notch, helicase C domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACAATCCCCGCCTCCATCCACACACACA |
| Internal bar code: | CACCCCGCAACCCTGGCCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 366 |
| LEAP-Seq percent confirming: | 24.5176 |
| LEAP-Seq n confirming: | 775 |
| LEAP-Seq n nonconfirming: | 2386 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTGAATGGAGGTGAAGG |
| Suggested primer 2: | GATTTCGTGGTGGAAGAGGA |