| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.174456 |
| Chromosome: | chromosome 3 |
| Location: | 4451500 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175800 | RIMM,RRM16 | Putative chloroplast ribosomal RNA small subunit methyltransferase E; (1 of 1) 2.1.1.193 - 16S rRNA (uracil(1498)-N(3))-methyltransferase / M(3)U(1498) specific methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGTGCACCCCGACCTGCATGCACACACG |
| Internal bar code: | AACTTCTGATCAATCGCACACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 355 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGAGTCACACCTCCAACA |
| Suggested primer 2: | GCATTGGGCAATAAAATGCT |