Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.174576 |
Chromosome: | chromosome 12 |
Location: | 7286561 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g557700 | (1 of 1) K01069 - hydroxyacylglutathione hydrolase (E3.1.2.6, gloB) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACCCATCACGCCGCCCAGAACAAACAGCC |
Internal bar code: | CATGTTGGTACGCGCTGTGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 601 |
LEAP-Seq percent confirming: | 76.4524 |
LEAP-Seq n confirming: | 78931 |
LEAP-Seq n nonconfirming: | 24311 |
LEAP-Seq n unique pos: | 109 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGACTCCTGAAGCACACA |
Suggested primer 2: | TGCCCCTTACTTCTTGCCTA |