| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.177253 |
| Chromosome: | chromosome 10 |
| Location: | 3489988 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445000 | SLT2 | Sodium/sulfate co-transporter 2; (1 of 2) PF00939//PF02080 - Sodium:sulfate symporter transmembrane region (Na_sulph_symp) // TrkA-C domain (TrkA_C) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGATGTGTGCGCTACGAGCGAACCGCG |
| Internal bar code: | CCGTGTAGTTCATGCACTGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 709 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 120 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCAGGAAATATCGAGGG |
| Suggested primer 2: | ACTGCAACCCACTTGGAATC |