| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.177627 |
| Chromosome: | chromosome 16 |
| Location: | 3206789 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g666334 | RFS1 | (1 of 1) 2.4.1.82 - Galactinol--sucrose galactosyltransferase / Raffinose synthase; putative raffinose synthase | CDS|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTCCTGCGTCTGGAGAGCGGCTCTCCC |
| Internal bar code: | CATTAGGGTGCGTTGTGCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 99.5726 |
| LEAP-Seq n confirming: | 1165 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCGTCTTCGAGCTCCTTA |
| Suggested primer 2: | CACCATTTCACCGAGTCCTT |