| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.177769 |
| Chromosome: | chromosome 12 |
| Location: | 5545351 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531400 | NPHP4,NPH4,POC10 | (1 of 1) K16478 - nephrocystin-4 (NPHP4); Proteome of centriole protein 10 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCCAAGGCATCAATCATCTCCAAGGGC |
| Internal bar code: | GACATGCCGTTTCTCTGATGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 956 |
| LEAP-Seq percent confirming: | 99.7729 |
| LEAP-Seq n confirming: | 1318 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCATGTAGGTTGACAGGGG |
| Suggested primer 2: | GCGCTTACCGGTACATCATT |