Insertion junction: LMJ.RY0402.178548_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.178548
Chromosome:chromosome_1
Location:7071229
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g051050 FAP225 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTCATGAATTGCAGTCCTGTGCCCATGTGG
Internal bar code:ATCAAACGGTCACGGCCGGGAT

Confirmation - LEAP-Seq

LEAP-Seq distance:558
LEAP-Seq percent confirming:99.7691
LEAP-Seq n confirming:432
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GAAACTATTGCCGCAGAAGC
Suggested primer 2:CACGCGACCCACATACATAG