Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.178917 |
Chromosome: | chromosome 7 |
Location: | 1244660 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g321400 | MAW6,FAP113 | (1 of 1) PF13948 - Domain of unknown function (DUF4215) (DUF4215); Membrane-associated hydroxyproline-rich glycoprotein 6 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGAAACTGGCGGGCGGAACCGGGGGGG |
Internal bar code: | CGTGAGGAGTGGGCCATTAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 47 |
LEAP-Seq percent confirming: | 56.7164 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGTGGCGTAGGTGATCTT |
Suggested primer 2: | GCACCTTCCTCAGTCCTCTG |